Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 2008;3:1101–8. Weintraub, H. et al. Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc. Natl. Acad. Sci. USA 86, 5434–5438 (1989). For offline cultivated B. subtilis expression cultures, sfGFP as well as split GFP (GFP11-tag combined with the non-fluorescent detector protein) fluorescence was determined after cultivation. In vitro split GFP assay was carried out in B. subtilis cell lysates mixed with a GFP1-10 detector solution. GFP1-10 was produced externally by E. coli BL21(DE3) with pET22b- sfGFP1-10 in inclusion bodies as described previously [ 18] and solved in 100 mM Tris-HCl pH 7.4, 100 mM NaCl, 10% (v/v) glycerol, 173 mM Urea, 10 mM EDTA to obtain the detector solution. For B. subtilis cell lysis, 100 µl of gus or gus11 expressing B. subtilis cultures were mixed with 25 µl PBS buffer (137 mM NaCl, 2.7 mM KCl, 8 mM Na 2HPO 4, 1.76 mM KH 2PO 4, pH 7.4) containing 10 mg/ml lysozyme. After incubation at 37 °C for at least 30 min, 20 µl cell lysates were mixed with 180 µl detector solution and were incubated at room temperature for at least 16 h as described previously [ 17]. Organic - All of our ingredients are organically grown wherever possible, without the use of herbicides and pesticides which can be damaging to our environment. All of our products are made from 100% plant-based sources to minimise the impact made from animal agriculture

Many laboratories that study protein corona have expertise in characterizing and analysing the physicochemical properties of the protein corona in house, but they are not necessarily specialized in MS-based proteomics; therefore, they rely on core facilities for proteomic analysis of their samples. As different MS-based proteomics laboratories and/or core facilities may use different methods in their LC–MS/MS workflow, different instruments, equipment and commercial software, one can expect that the heterogenicity of the outcomes would be substantial 99, 119, 120, 121, 122. To shed more light on how much and to what extent LC–MS/MS characterization and analysis can affect protein corona outcomes, 17 identical aliquots of corona-coated polystyrene NPs were sent to 17 different laboratories/core facilities for proteomics analysis 123. The outcomes were surprising: out of 4,022 identified unique proteins in the protein corona layer, only 73 (1.8%) were shared across the laboratories and/or core facilities. It is noteworthy that the technical repeats from each of the core facilities revealed reproducible results, which emphasizes that using the identical sample preparation approach and instrumentation can provide reliable results. The observed heterogeneity across laboratories and/or core facilities, however, is an extremely important point, which needs to be seriously considered in nanomedicine literature, as any interpretation regarding the interactions of NPs with biological systems heavily relies on the composition of protein corona. To improve the reliability and robustness of protein corona data, the nanobio interface community should develop standard protocols on methodologies, analysis, reporting and interpretation of LC–MS/MS data. AI and the protein corona The amount of sfGFP, GFP1-10 and GFP1-10(TGA11) transcripts was analyzed by RT-qPCR as described previously [ 43]. RNA was isolated in three steps from 500 µL expression culture using the NucleoSpin ® RNA Kit (Macherey–Nagel, Düren, Germany), the RNase-Free DNase Set (Qiagen, Hilden, Germany) and the Ambion DNA-free™ DNA Removal Kit (Thermo Fisher Scientific, Dreieich, Germany). The cDNA was synthesized with 1 µg RNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, St. Leon-Roth, Germany). RT-qPCR was performed with 50 ng cDNA using the Maxima SYBR/ROX qPCR Master Mix (Thermo Fisher Scientific, St. Leon-Roth, Germany) with the primer pairs SigA-left (5′ ATCGCCTGTCTGATCCACCA 3′)/SigA-right (5′ GGTATGTCGGACGCGGTATG 3′) for amplification of constitutively expressed major sigma factor gene sigA and GFP-left (5′ AAACATTCTCGGACACAAAC 3′)/GFP-right (5′ AATGGTCTGCTAGTTGAACG 3′) for amplification of sfGFP and the detector derivatives. Gene expression analysis was performed by using the 2 −ΔΔct method with an assumed PCR efficiency of 100% [ 44]. The expression levels of the detector genes were normalized to the level of the sigA gene and compared to the expression of sfGFP. Heterogeneity of reporter gene expression in B. subtilis Fluitt A, Pienaar E, Viljoen H. Ribosome kinetics and aa-tRNA competition determine rate and fidelity of peptide synthesis. Comput Biol Chem. 2007;31(5–6):335–46. In vivo protein formation is a crucial part of cellular life. The process needs to adapt to growth conditions and is exploited for the production of technical and pharmaceutical proteins in microbes such as Escherichia coli. Accordingly, the elucidation of basic regulatory mechanisms controlling the in vivo translation machinery is of primary interest, not only to improve heterologous protein production but also to elucidate fundamental regulation regimens of cellular growth. ResultsBruce JE (2012) In vivo protein complex topologies: sights through a cross-linking lens. Proteomics 12:1565–1575 Morera S, Lacombe M-L, Xu Y et al (1995) X-Ray structure of nm23 Human Nucleoside Diphophate Kinase B complexed with GDP at 2A resolution. Structure 3:1307–1314 Harwood CR, Wipat A. Sequencing and functional analysis of the genome of Bacillus subtilis strain 168. FEBS Lett. 1996;389:84–7.

The initial molecule distribution is set randomly for ternary complexes and ribosomes and the initial states of the ribosomes are uniformly distributed throughout the entire sequence. Translation, termination, and initiation were omitted in this model and ribosomes reaching the end of the sequence were set to the first codon. Furthermore, the entire calculation is nested in a loop with the stop criterion set to 5000 successful elongation steps. The specific elongation rate is calculated as the slope of step number over their respective time points. The resulting slope (elongations per second or amino acids per second) is normalized on the ribosome count, resulting in the specific elongation rate (elongations/amino acids per second per ribosome). The corresponding error is based on the deviation between ten different simulation runs with varying seeds for the random number generator. Initial conditions Microfluidic experiments were performed on an inverted automated microscope (Nikon Eclipse Ti, Nikon, Tokyo, Japan), equipped with a focus correction system compensating focus drift during time-lapse imaging. A benchtop incubation chamber (PECON, Erbach, Germany) ensured constant temperature conditions. The inlets to the microfluidic channels on the chip were connected to a syringe pump (neMESYS, CETONI, Korbussen, Germany) for continuous medium supply. Nikon software NIS Elements AR 4.30.02 was used for automated time-lapse imaging. The microfluidic chip was placed in an in-house fabricated chip-holder and phase contrast and fluorescence images were taken every 10 min using a 100 × oil immersion objective (CFI Plan Apo Lambda DM 100 × -magnification, NA 1.45). The propidium iodide fluorescence was captured through a mCherry filter (λ ex = 562 nm, λ em = 641 nm, DM = 593 nm) and GFP fluorescence was captured through a GFP filter (λ ex = 500 nm, λ em = 542 nm, DM = 520 nm). Summarizing, elongations of non-native (GFP) and native (EFTu) protein sequences reveal strong dependencies on ribosomal availability irrespective of the concentration level. However, the sensitivity is much more pronounced for native sequences. Increasing ribosomal availability may be a general option for improving translation capacities. However, from a cellular perspective, this option comes with ATP expense for ribosome formation, which will be discussed in the next section. Improving translation with minimum ATP needsLascu I, Gonin P (2000) The catalytic mechanism of nucleoside diphosphate kinases. J Bioenerg Biomembr 32:237–246 Hawkins, T.L., O'Connor-Morin, T., Roy, A. & Santillan, C. DNA purification and isolation using a solid-phase. Nucleic Acids Res. 22, 4543–4544 (1994). Cohen J, Cohen P, West SG, Aiken LS. Applied multiple regression/correlation analysis for the behavioral sciences. New York: Routledge Taylor & Francis Group; 2003. p. 703. Natoli, G. Maintaining cell identity through global control of genomic organization. Immunity 33, 12–24 (2010). Lindner AB, Madden R, Demarez A, Stewart EJ, Taddei F. Asymmetric segregation of protein aggregates is associated with cellular aging and rejuvenation. Proc Natl Acad Sci USA. 2008;105:3076–81.