2(013)
- Brand: Unbranded
Description
MV411 cells (1.5 × 10 7) were seeded at 1 × 10 6 per mL and treated with DMSO (0.1% final) or 10 µM JTE-013 for 6 h. Cells were pelleted by centrifugation, washed in PBS and snap frozen. The cell pellets were suspended in 1 mL of chilled PBS and centrifuged at 2000× g for 5 min at 4 °C. The supernatant was discarded and the remaining solid was resuspended in 450 µL of extraction mix [chloroform: methanol: H 2O, 2:6:1 (v/v)]. Odd chain lipid standards mix was added to give final concentrations of 241 nM sphingosine (d17:1), 250 nM dihydosphingosine (d17:0), 253 nM S1P (d17:1), 235 nM dihydrosphingosine 1-phosphate (d17:0), 250 nM sphingomyelin (d18:1/17:0), and 450 nM C17 ceramide (d18:1/17:0). The samples were frozen/thawed three times, then centrifuged at 14,800× g for 5 min at 4 °C. 400 µL of supernatant was then transferred to new tubes, with some remaining sample combined to make a pooled QC sample. To reconstitute, the solvent was evaporated to dryness keeping the samples in a centrifugal evaporator at 55 °C for 50 min. Dried extracts were frozen at – 80 °C until LC–MS analysis was performed. On the day of analysis, the samples were dissolved in 180 µL of butanol: methanol (v/v 1:1) mixture and 20 µL of water. The samples were vortexed on a rotary vortex for 10 min and sonicated in a sonicator bath for 1 h keeping the temperature below 25 °C. The samples were centrifuged at 14,800× g for 10 min at 20 °C and transferred to LC–MS vials. Lim, K. G. et al. Inhibition kinetics and regulation of sphingosine kinase 1 expression in prostate cancer cells: Functional differences between sphingosine kinase 1a and 1b. Int. J. Biochem. Cell Biol. 44, 1457–1464. https://doi.org/10.1016/j.biocel.2012.05.012 (2012). Pitman, M. R., Pham, D. H. & Pitson, S. M. Isoform-selective assays for sphingosine kinase activity. Methods Mol. Biol. 874, 21–31. https://doi.org/10.1007/978-1-61779-800-9_2 (2012).
The relationship between sphingosine-1-phosphate receptor 2 and epidermal growth factor in migration and invasion of oral squamous cell carcinoma Powell, J. A. et al. Targeting sphingosine kinase 1 induces MCL1-dependent cell death in acute myeloid leukemia. Blood 129, 771–782. https://doi.org/10.1182/blood-2016-06-720433 (2017). Park, S. J. & Im, D. S. Deficiency of sphingosine-1-phosphate receptor 2 (S1P2) attenuates bleomycin-induced pulmonary fibrosis. Biomol. Ther. 27, 318–326. https://doi.org/10.4062/biomolther.2018.131 (2019).Song, J. H., Kim, G. T., Park, K. H., Park, W. J. & Park, T. S. Bioactive sphingolipids as major regulators of coronary artery disease. Biomol. Ther. 29, 373–383. https://doi.org/10.4062/biomolther.2020.218 (2021).
Pitman, M.R., Lewis, A.C., Davies, L.T. et al. The sphingosine 1-phosphate receptor 2/4 antagonist JTE-013 elicits off-target effects on sphingolipid metabolism. Best viewed in landscape mode (turn your phone sideways) on mobile devices and any device with a small screen. Kang, J., Lee, J. H. & Im, D. S. Topical application of S1P2 antagonist JTE-013 attenuates 2,4-dinitrochlorobenzene-induced atopic dermatitis in mice. Biomol. Ther. 28, 537–541. https://doi.org/10.4062/biomolther.2020.036 (2020). Salomone, S. & Waeber, C. Selectivity and specificity of sphingosine-1-phosphate receptor ligands: Caveats and critical thinking in characterizing receptor-mediated effects. Front. Pharmacol. 2, 9. https://doi.org/10.3389/fphar.2011.00009 (2011).
Stay Connected
To generate doxycycline-inducible S1P 2 shRNA contructs the pTRIPz lentiviral vector was modified with the addition of a poly-linker as described previously 13. shRNA target sequences from Fellmann et al. 42, S1PR2 (5′ TGCTGTTGACAGTGAGCGCAAGGCACTGACTAGTCACATATAGTGAAGCCACAGATGTATATGTGACTAGTCAGTGCCTTATGCCTACTGCCTCGGA) and Renilla luciferase 713 negative control (5′ TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA). shRNA oligonucleotides were amplified using EcoRI MirE primers (5′ TAGAATTCTGCACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG, 3′ TCTCGAATTCTAGCCCCTTGAAGTCCGAG-GCATAGGC). PCR products were digested with EcoRI and cloned into pTRIPZ. To generate lentivirus, HEK293T cells were co-transfected with this vector (or empty pTRIPZ) and pLP1 (gag/pol), pLP2 (rev), pTAT and pVSVG vectors using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two days after transfection the media was changed from DMEM (10% FBS) to RPMI (10% FBS) and incubated for a further two days. The viral supernatant was then added to 5 × 10 6 MV411 cells containing 4 µg/ml polybrene and incubated for an additional 72 h prior to selection with 1 µg/ml of puromycin. Doxycycline induced RFP expression confirmed transduction efficiencies of > 80%. Newton, J., Lima, S., Maceyka, M. & Spiegel, S. Revisiting the sphingolipid rheostat: Evolving concepts in cancer therapy. Exp. Cell Res. 333, 195–200. https://doi.org/10.1016/j.yexcr.2015.02.025 (2015). French, K. J. et al. Discovery and evaluation of inhibitors of human sphingosine kinase. Cancer Res. 63, 5962–5969 (2003).
Green, C. D., Maceyka, M., Cowart, L. A. & Spiegel, S. Sphingolipids in metabolic disease: The good, the bad, and the unknown. Cell Metab. 33, 1293–1306. https://doi.org/10.1016/j.cmet.2021.06.006 (2021). Li, C. et al. Sphingosine 1-phosphate receptor 2 antagonist JTE-013 increases the excitability of sensory neurons independently of the receptor. J. Neurophysiol. 108, 1473–1483. https://doi.org/10.1152/jn.00825.2011 (2012). The sphingosine 1-phosphate receptor 2/4 antagonist JTE-013 elicits off-target effects on sphingolipid metabolism Bandhuvula, P., Tam, Y. Y., Oskouian, B. & Saba, J. D. The immune modulator FTY720 inhibits sphingosine-1-phosphate lyase activity. J. Biol. Chem. 280, 33697–33700. https://doi.org/10.1074/jbc.C500294200 (2005).
Pyne, N. J. & Pyne, S. Selectivity and specificity of sphingosine 1-phosphate receptor ligands: “off-targets” or complex pharmacology?. Front. Pharmacol. 2, 26. https://doi.org/10.3389/fphar.2011.00026 (2011). French, K. J. et al. Pharmacology and antitumor activity of ABC294640, a selective inhibitor of sphingosine kinase-2. J. Pharmacol. Exp. Ther. 333, 129–139. https://doi.org/10.1124/jpet.109.163444 (2010). The computer you are using is not registered by an institution with a subscription to this article. Please choose Bonhoure, E. et al. Overcoming MDR-associated chemoresistance in HL-60 acute myeloid leukemia cells by targeting sphingosine kinase-1. Leukemia 20, 95–102. https://doi.org/10.1038/sj.leu.2404023 (2006). Fraud is a constant threat, and those who commit fraud take money away from public services and those who rely on them. The increase in fraud threat during COVID-19 reminds us that fraud is an increasingly complex and dynamic crime, and it requires skill, capability and commitment to mitigate it effectively.
- Fruugo ID: 258392218-563234582
- EAN: 764486781913
-
Sold by: Fruugo